![]() Humanized mouse
专利摘要:
Provided are: an embryonic stem cell produced by culturing an embryo from an immunodeficient mouse, which lacks both Rag2 gene and Jak3 gene, in the presence of a GSK3 inhibitor and an MEK inhibitor; and a transgenic mouse produced using the embryonic stem cell. 公开号:AU2012374750A1 申请号:U2012374750 申请日:2012-03-27 公开日:2014-10-16 发明作者:Kimi Araki;Seiji Okada;Akihiko SHIMONO;Ken-Ichi Yamamura 申请人:TRANS GENIC Inc;Kumamoto University NUC; IPC主号:A01K67-027
专利说明:
G1097 SPECIFICATION HUMANIZED MOUSE 5 TECHNICAL FIELD The present invention relates to embryonic stem cells (ES cells) taken fom an imnmnodeficient mouse, and a mouse with a humanized liver. 10 BACKGROUND ART The liver is an organ which plays a dominant role in vivo, e.g., in metabolism, excretion, detoxication, and maintenance of body fluid homeostasis. The liver is the only regenerating organ in the body and is known to have the regeneration ability to 15 recover its initial weight even if about 80% of its total weight is excised. The liver has a wide range of functions and hence many genes are expressed in the liver, so that there are also many hereditary diseases caused by abnormalities in the genes expressed in the liver In some cases where liver functions become abnormal due to liver diseases 20 and others, there is no effective therapy except for liver transplantation. For this reason, there has been an increasing necessity to predict human blood metabolites at the early stage of onset. To properly predict blood metabolites and liver functions, there is a need for the development of an animal with a humanized liver. Among previous reports on the preparation of human liver model mice, for 25 example, Heckel et al. have reported transgenic mice (Tg(Alb-Plau)) carrying a construct (Alb-Plau) composed of the urokinase-type plasminogen activator (Plau) gene linked to the albumin (Alb) promoter (Non-patent Document 1: Heckel et al, Cell 62:44>456, 1990)). However, these mice cannot be used for experiments because they will die within 4 days after birth due to hemorrhage in their intestinal tract and 30 elsewhere. On the other hand, the same research group has succeed in establishing lines of survivors among Tg(Alb-Plau) mice and has reported a case where the liver was regenerated from liver cells which were deficient in the Alb-Plau gene during liver cell division (Non-patent Document 2: Sandgren et al, Cell 66:245-256, 1991). Moreover, there is a report showing successful transplantation of Tg(Alb-Plau) with I G1097 mature liver cells from a transgenic mouse (Tg(MT-nLacZ) mouse) carrying a construct composed of the lacZ gene linked to the netallothionein promoters Ie., a mouse whose liver cells serving as a donor were labeled with the marker gene lacZ (Non-patent Document 3: Rhim et al. Science 263:1149-1152, 1994), 5 In addition, there are reports on the transplantation of imunodeficient nice with human liver cells, as exemplified by a report in which Rag2-/- gene-deficient immunodeficient mice were transplanted with liver cells, followed by infection experiment with hepatitis B virus (HBV) (Non-patent Document 4: Dandri et al. Hepatology 33:981-988, 2001), or a report in which Tg(Alb-Plau) mice were crossed 10 with SCID mice, which are immunodeficient mice, and the resulting inutnmodeficient SCID mice (Tg(Alb-Plau)) were then transplanted with human liver cells (Tg(Alb Plan);SCID)), followed by infection experiment with hepatitis C virus (Non-patent Document 5: Mercer et alt Nature Med. 7:927-933, 2001). Further, Tateno et al. have reported that albumin enhancer/promoter urokinase 15 plasmninogen activator transgenic mice (uPA mice) undergoing liver failure were crossed with SCID mice to prepare uPA/SCID transgenic mice hontozygouse for both characters (Non-patent Document 6: Tateno et al. Amer. J. Pathol 165:901-912, 2004). This report discusses improved techniques for transplantation of human liver cells into Tg(Alb-Plau;SCID), in which Futhan treatment is used to eliminate the effects of 20 complements derived from human liver cells to thereby reduce the mortality even at high chimerism. Moreover, there is a report on the study which demonstrates the possibility of Rag2 gene-deficient irmmunodeficient mice as a model for gene therapy (Non-patent Document 7: Orthopedic Surgery and Traumatology "Series IV of Orthopedic Diseases 25 from the Molecular Level. Somatic Cell. Cloning Technology and Regenerative Medicine" Vol. 45, NO. I1, PAGE 1040-1041, 2002) However, these model mice do not serve as a liver cell model in which 100% of the cells have been replaced with cells of human origin, because host mouse liver cells are left therein. in addition, cells of human origin do not always regenerate, so 30 that cells of human origin should be transplanted. Moreover, when liver cells of mouse origin are left, human liver functions cannot be verified sufficiently. On the other hand, for establishment of NOG mouse-derived ES cell lines for germ-line transmission, some attempts have also been made to establish ES cells by using differentiaton signal inhibitors (PD0325901, CHIR99021) (Non-patent 2 G1097 Document 8: Abstracts of the Annual Meeting of the Japanese Association for Laboratory Animal Science, Vol. 58th, Page 210, 2011). However, NOG mice are difficult to obtain in large number for use in experiments because they are difficult to breed. 5 Prior Art Documents Non-patent Documents Non-patent Document 1: Heckel et al. Cell 62:447-456, 1990 Non-patent Document 2: Sandgren et al. Cell 66:245-256, 1991 10 Non-patent Document 3: Rhim et al. Science 263:1149-1152, 1994 Non-patent Document 4: Dandri et al. Hepatology 33:981 988,2001 Non-patent Document 5: Mercer et al. Nature Med. 7:927-933. 2001 Non-patent Document 6: Tateno et al. Amer. J. Pathol 165:901-912, 2004 Non-patent Document 7: Orthopedic Surgery and Traumatology "Series IV of 15 Orthopedic Diseases from the Molecular Level, Somatic Cell Cloning Technology and Regenerative Medicine" Vol, 45, NO. 11, PAGE 1040-1041, 2002 (in Japanese) Non-patent Document 8: Abstracts of the Annual Meeting of the Japanese Association for Laboratory Animal Science, Vol. 58th, Page 210, 2011 (in Japanese) 20 SUMMARY OF THE INVENTION PROBLEM TO BE SOLVED BYTHE INVENTION The oblject of the present invention is to provide embryonic stem cells (ES 25 cells) taken from an immunodeficient mouse, and a mouse with a humanized liver. MEANS TO SOLVE THE PROBLEM As a result of extensive and intensive efforts made to solve the problems 30 stated above, the inventors of the present invention have found that embryonic stem cells which can be used to create a mouse most suitable fir human liver cell transplantation are obtained from an embryo of an. imnmnodeficient mouse which is deficient in both Rag2 and Jak3 genes. This finding led to the completion of the present invention. G1097 Namely, the present invention is as follows, (1) An embryonic stem cell obtainable from an embryo of an immunodeficient mouse which is deficient in both Rag2 and Jak3 genes by culture in the presence of a GSK3 inhibitor and an MEK inhibitor. 5 (2) The embryonic stem cell according to (1) above, which is deposited under Accession No. NITE BP-1297. (3) The embryonic stem cell according to (1) or (2) above, which is engineered to have the estrogen receptor gene and the diphtheria toxin gene. (4) The embryonic stem cell according to (3) above, wherein the endogenous 10 growth hormone gene in the cell is replaced with that of human origin. (5) The embryonic stem cell according to (4) above, wherein an endogenous drug-metabolizing enzyme gene in the cell is further replaced with that of human origin. (6) The embryonic stem cell according to (5) above, wherein the endogenous 15 drug-metabolizing enzyme gene in the cell is at least one selected from the group consisting of Cyp3al 1, Cyp3al3, Cyp3a25 and Cyp3a4l. (7) A mouse, which is created with the use of the embryonic stem cell according to (1) or (2) above. (8) A transgenic mouse, which is created with the use of the embryonic stem cell 20 according to any one of (3) to (6) above. (9) The mouse according to (8) above, which develops liver cell injury upon administration of an antiestrogen. (10) A mouse with a humanized liver, wherein the mouse according to (7) above is transplanted with liver cells of human origin and also administered with an 25 antiestrogen to eliminate liver cells originating from, the mouse. (11) The mouse according to (9) above, wherein the liver cells of human origin are derived frorn a patient with a liver disease, (12) A human liver disease model mousehich consists of the mouse according to (10) above. 30 (13) A method for preparing an imnmnodeficient mouse-derived embryonic stem cell, which comprises culturing an embryo of an immunodeficient mouse which is deficient in both Rag2 and Jak3 genes in the presence of a GSK3 inhibitor and an MEK inhibitor (14) A method for creating a liver injury model mouse, which comprises 4 G1097 administering an antiestrogen to the mouse according to (8) above. (15) A method for creating a mouse with a humanized liver, which comprises transplanting liver cells of human origin into the mouse according to (8) above and also administering an antiestrogen to eliminate liver cells originating from the mouse. 5 (16) The method according to (15) above, wherein the liver cells of human origin are derived from a patient with a liver disease. EFFECTS OF THE INVENTION 10 The present invention provides embryonic stem cells for establishment of a mouse most suitable for human liver cell transplantation. The embryonic stem cells of the present invention can be engineered to have various human genes related to liver functions to thereby establish a humanized liver model mouse. Thus, a mouse established from the embryonic stem cells of the present invention is very useful in that 15 it can be used for human liver cell transplantation and achieves 100% humanization. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows lox uutants. 20 Figure 2 shows the Dre/rox system. Figure 3 shows a scheme for construction of a replacement vector used for introduction of the human growth hormone gene into ES cells, Figure 4 shows a scheme for construction of a replacement vector used for introduction of a human drug-metabolizing enzyme gene into ES cells. 25 Figure 5 shows a scheme for the process starting from introduction of the diphtheria toxin gene into ES cells until cell death in mouse liver cells. Figure 6 shows the site for transplantation of human liver cells into a mouse embryo. Figure 7 shows mouse embryos transplanted with human liver cells, 30 S1: Intraperitoneal administration of an anesthetic agent, S2: Fetus exposed extraperitoneally by laparotomy A: Yolk sac vessel into which cells are to be injected, B: Cell injection site (yellow arrows), C: Liver after blue dye inj ection (seen in blue), D: Excised livers (left: liver after blue dye injection, right: liver without dye injection() G1097 Figure 8 shows liver cells induced to differentiate from iPS cells. Figure 9 shows liver cells induced to differentiate from iPS cells. DESCRIPTION OF EMBODIMENTS 5 The present invention will be described in more detail below. 1. Summary The present invention has been made to provide embryonic stem cells 10 established from an imnmunodeficient mouse which is deficient in both Rag2 and Jak3 genes, and to establish a mouse with a humanized liver from these embryonic stem cells. In the present invention, an embryo taken from the i-nmunodeficient mouse is cultured in the presence of a GSK3 inhibitor and an MEK inhibitor to thereby 15 successfully establish ES cells. A BALB/c mouse deficient in Rag2 and Jak3 (BALB/c;Rag2J-;Jak3A: hereinafter referred to as "BRJ mouse") is an immunodeficient mouse which lacks T cells, B cells, NK cells and NKT cells and has the genetic background of BALB/c mice. When this mouse is transplanted with human cells, these cells are engrafted in the 20 mouse body, so that the resulting mouse is humanized at the cellular level. However in such a humanized mouse, cells originating from the host mouse are left therein, and hence all of its organs are not replaced with those of human origin. For this reason, such a humanized mouse is not necessarily optimized for functional analysis or study on these organs. Moreover, various genetic modifications are 25 required to prepare an optimized mouse, although a whole mouse cannot be used for this purpose. Thus, for establishment of a mouse with a liver whose cells have all been humanized, the present invention aims to establish a genetically modified mouse which is most suitable for humanization. As a result of extensive and intensive efforts 30 aimed at humanization from the early stage of ontogeny in this genetically modified mouse, the inventors of the present invention have succeeded in establishing embryonic stem cells (hereinafter referred to as "ES cells") from BRJ mice. The inventors of the present invention have also succeeded in preparing a chimeric mouse using the ES cells to thereby prepare a gernine chimeric mouse for germi-line 6 G1097 transmission. Next, for maintenance of liver functions over a long period of time and for confirmation of the safety, the present invention aims to establish a mouse with a human normal liver. Moreover for establishment of a disease model havingz the same symptoms as seen in human patients with liver disease and for analysis of the 5 pathology, the present invention aims to establish a mouse with a human mutated liver. Furthenore, for development of a novel therapy used for a wide range of purposes, the present invention aims to establish a model mouse optimized for human diseases. 2. Preparation of BRJ mouse 10 The immunodeficient mouse to be used is a mouse whose Rag2 and Jak3 genes are both knocked out, which has already been established (Ono A, Hattori S, Kariya R, Iwanaga S, Taura M, Harada H, Suzu S, Okada S. Comparative study of human hematopoietic cell engraftment into BALB/c and C57BL/6 strain of rag-2/jak3 double-deficient mice. JBioned Biotechnol 2011:539748, 2011), 15 This mouse can be obtained by crossing between a Rag2 gene-deficient mouse and a Jak3 gene-deficient mouse, The Rag (recombination activating gene) 2 gene is expressed in immature lymphocytes and has functions essential for rearrangement of immunoglobulin genes and T cell receptors, and is therefore a gene indispensable for maturation of T cells and 20 B cells, ILow to prepare a mouse knockout of this Rag2 gene and details on this gene can be found in, e.g., Shinkai Y. et al, Cell. 1992 Mar 6;68(5):855-67, Chen J. et al, Curr Opin Immunol. 1994 Apr;6(2):3 13-9. In general, such a mouse can be prepared by any technique well known in the art, e.g., the technique using a targeting vector 25 (Capecchi, M, R., Science, (1989) 244, 12881292). This technique is based on homologous recorbination between the Rag2 gene in mouse ES cells and a gene on the targeting vector. Jak3 (Janus kinase 3), which is a non-receptor tyrosine kinase, is a protein having the function of associating with the intracellular region of the common y chain, 30 which is common to IL-2, IL-4, IL-7, IL-9 IL-15 and IL-21 receptors, to thereby transduce signals into cells through the common y chain. Signals through the common y chain and Jak3 are essential for NK cells, and hence damage to this pathway will cause NK cell deficiency Namely, when the Jak3 gene is knocked out, NK activity can be eliminated. 7 Gi097 Details on the Jak3 gene and the common y chain gene can be found in, e.g., Park SY. et al- Inmunity. 1995 Dec3(6):771-82, Suzuki K. et aL, Int inmiunol. 2000 Feb;12(2):123-32, and it is possible to obtain a mouse which is deficient in the Jak3 gene and loses NK activity, by reference to these documents. 5 It should be noted that a Rag2-deficient (4/) mouse and a Jak3-deficient (4) mouse are also available from the Institute of Resource Development and Analysis, Kumamoto University, Japan. These mice can be back-crossed with commercially available BALB/c mice to thereby obtain a BALBc Rag2-deficient (4) mouse and a BALB/c Jak3-deficient (--) mouse, respectively, each having the same genetic 10 background as BALB/c mice. To prepare a double knockout mouse deficient in both Rag2 and Jak3 genes, the BALB/c Rag2-deficient mouse and the BALB/c Jak3-deficient mouse are first crossed with each other to obtain F1 mice, followed by crossing between F1 mice to obtain F2 mice. From among these mice, a double-deficient, i.e., Rag2-deficient (-/-) 15 and Jak3-deficient (4-) mouse (BJ mouse) may then be selected. As to techniques for BRJ mouse selection, for example, deficiencies in both Rag2 and Jak3 genes can be confirmed by PCR or Southern blotting. 3. Establishment of ES cells 20 The ES cells of the present invention can be obtained from embryos taken from BRJ mice obtained as above by culture in the presence of a GSK3 inhibitor and an MEK inhibitor. First, from female BRJ mice after fertilization, fertilized eggs or two-cell embryos are obtained by culture or blastocysts are obtained directly Fertilization 25 may be accomplished by natural crossing or in vino fertilization techniques. In the case of in vitro fertilization, ova obtained by superovulation of female mice and sperm taken from male mice may be cultured together. Then, the collected blastocysts or inner cell mass niay be cultured in a medium for animal cell culture in the presence of a GSK-3 inhibitor and an MEK 30 inhibitor for about I to 3 weeks, preferably 14 to 18 days. GSK-3 (glycogen synthase kinase 3), which is a serine/threonine protein kinase, is an enzyme acting on many signaling pathways responsible for glycogen production, apoptosis, stem cell maintenance and other events. Examples of a GSK-3 inhibitor include CIR99021 (available from Wako Pure Chemical Industries, Ltd., 8 G1097 Japan), 6-bromoindirubin-Y-oxime (BIO) (available from Wako Pure Chemical Industries, Ltd., Japan) and so on. Such a GSK-3 inhibitor may be added to the medium in an amount of 0.1 to 10 ptM (micromolar), preferably 0.3 to 3 tM. The timing of GSK-3 inhibitor addition to the medium is not limited in any way, but it is 5 preferably added from the beginning of blastocyst culture. An MEK inhibitor is a protein kinase inhibitor which inhibits MAP Kinase Kinase (MEK) activity and suppresses ERKI/ERK2 activation. Examples of an MEK inhibitor include PD0325901 (available from Wako Pure Chemical Industries, Ltd., Japan), U0126 (available from Promega) and so on. The PD0325901 inhibitor 10 may be added to the medium in any amount, for example, 3 paM. Culture may be accomplished under any conditions, for example, at 37 0 C in a 5% CO 2 atmosphere. Subculture may be conducted at an interval of 3 to 4 days on mouse embryo fibroblast (MEF) feeders or on collagenase 1-coated plates. Examples of the above medium include GMEM medium (Glasgow's Minimal 15 Essential Medium), DMEM (Dulbecco' Modified Eagle's Medium), RPMI 1640 medium and so on. The culture medium may be supplemented as appropriate with an additional ingredient(s) selected fiom KSR (knockout serum replacement), fetal bovine serum (FBS), basic fibroblast growth factor (bFGF), I-mercaptoethanol, nonessential amino acids, glutamic acid, sodium pyruvate and antibiotics (e.g., penicillin, 20 streptomycin), etc. Culture may be continued for a given period of time, followed by incubation in a medium containing EDTA or collagenase IV to collect ES cells. The collected ES cells may optionally be subeultured several times by culture in the presence or absence of feeder cells. It should be noted that inner cell mass culture under feeder 25 free conditions may be conducted in an MEF-conditioned medium. The cultured ES cells may usually be identified using their marker genes. Examples of marker genes in ES cells include Oct3/4, alkaline phosphatase, Sox2, Nanog, GDF3, REX1, FGF4 and so on. The presence of marker genes or gene products may be detected by any technique such as PCR or Western blotting. 30 Moreover, to determine whether or not the ES cells of the present invention are obtained as desired, whether they are of BALB/c origin can be confirmed by SNP marker detection, while whether they are Rag2-deficient and lak3-deficient can be confirmed by PCR or Southem blotting analysis. For example, a database of mouse SNPs is published at http:/wwbroadinstituteorg/snp/mouse, and when SNP 9 G1097 information is compared against this database, the ES cells can be confirmed to be of BALB/c origin, while if the ES cells are found to be deficient in Rag2 and Jak3 genes, they are determined to be the ES cells of the present invention. The thus obtained ES cells were designated as "BRJS" and internationally 5 deposited under the Budapest Treaty on March 23, 2012 (receipt date) with the National Institute of Technology and Evaluation, Patent Microorganisms Depositary (Patent Microorganisms Depositary, Department of Biotechnology of NITE, 2-5-8 Kazusakamatari, Kisarazu-shi, Chiba 292-0818, Japan). Their Accession No. is "NITE BP-1297;" 10 Detailed information on the above ES cells is as follows, Articles have already been published about how to establish ES cells with a GSK inhibitor and an MEK inhibitor, and the resulting ES cells inherit genetic characters of their original lines and contain their respective unique features. Although there are various lines of immunodeficient mice, they have mutually 15 different gene mutations in addition to their original genetic background, so that different lines have different inherent features, For example, NOG mice, for which reports have been issued, are mice of NOD strain with SCID and a deficiency in the 1L2 receptor common gamma (IL2R-y) gene. NOD mice originally lack complements, A responsible gene for SCID is Prkdc (DNA-dependent protein kinase, 20 catalytic subunit), and this gene is necessary for rearrangement of immunoglobulin genes and '1 cell receptors. Thus, a mutation in this gene will inhibit the formation of B lymphocytes and T lymphocytes. Moreover IL2R-y is a common molecule that constitutes receptors for interleukins such as IL-2, IL-4. IL-7, IL-9, IL-15 and IL-21. Thus, a deficiency in this molecule will inhibit the transduction of signals mediated by 25 these interleukins, so that immune responses cannot be induced. Taken together, not only lack of complements, B lymphocytes and T lymphocytes, but also reduced functions of macrophages and/or dendritic cells are observed, thus resulting in a more severe immunodeficient state. However, due to severe irmunodeficiency, even opportunistic infection pathogens, which do not cause any problem at all in normal 30 mice, will be responsible for death in some cases, or thymoma will occur at high rate. On the other hand, BRJ miee are mice of BALB/c strain with deficiencies in the Rag2 and Jak3 genes, and are known for high engraftient rate of transplanted cells. Rag2 is a gene necessary for rearrangement of immunoglobulin genes and T cell receptors, as in the case of Prkdc, while Jak3 is a gene located downstream of IL2R-y, 10 G1097 so that deficiencies in these genes result in a severe imrnunodeficient state. However, BRJ mice are relatively easy to keep and breed. In preliminary experiments, attempts were made to establish ES cells in the conventionally used GMEM-KSR medium, but only a strain showing very poor growth 5 could be established. Even when used to prepare a chimeric mouse, this strain resulted in chimerism as low as 50% and did not contribute to the germ line. In contrast, in the present invention, a GSK3 inhibitor and an MEK inhibitor, which are considered to be effective for maintenance of the undifferentiated state of ES cells, were added to the medium to thereby achieve the establishment of the desired ES cells. J0 The ES cells of the present invention are high in viability and also high in chimerism. This is because the ES cells of the present invention successfully maintain their undifferentiated state in comparison with ES cells prepared by conventional techniques. One of the important signals responsible for differentiation of ES cells is the ERK/MEK pathway from FGF4 through FGF receptors. Namely, ERK acts as a 15 differentiation signal. On the other hand, GSK-3 stimulates Wnt signals through phosphorylation of p-catenin to thereby induce differentiation. Thus, by using two inhibitors (2i), i-e., a strong MEK inhibitor (PD0325901) and a GSK3 inhibitor, the ES cells of the present invention can be prevented from differentiation and hence maintain their pluripoteney. 20 4. Genetic modifications To establish a genetically modified mouse which is most suitable for humanization, endogenous genes should be replaced with those of human origin at the stage of ES cells, but not in adult mice, or ES cells should be transformed with human 25 genes, followed by creation of a mouse from the thus genetically modified and/or transfonned ES cells. Thus, in the present invention, for transformation of ES cells with desired genes or for replacement of endogenous genes in ES cells with human genes, homologous recombination with the foiiowing systems may be used: the 30 bacteriophage-derived recombination system Cre-loxP, the Vibrio sp.-derived recombination system VWre-Vlox, the Cre homolog-mediated recombination system Dre/rox, or any system modified from these combination systems, ioxP (locus of crossing (X/ring) over, P1) is a sequence of 34 nucleotides (5 ATAACTTCOTATA GCAIACAT TATACGAAGTTAT-) (SEQ ID NO; 1), in which 11 G1097 sequences of the 5-terminal 13 nucleotides (referred to as inverted repeat 1) and the 3 terminal 13 nucleotides (referred to as inverted repeat 2) each constitute an inverted repeat, and a sequence represented by "GCATACAT" which is called a 8-nucleotide spacer is sandwiched between the above inverted repeats I and 2 (Figure 1). The 5 tern "inverted repeat" is intended to mean a sequence, one of whose terminal segments is complementary to the other terminal segment in the direction opposite to each other, with sandwiching a spacer which serves as their boundary: Cre (causes recombination) is intended to mean a recombination enzyme (also referred to as a recombinase) which causes gene recombination, and it recognizes the 10 above repeats to cleave the spacer in such a cleavage fashion that "cataca" in the spacer segment is left as a cohesive end. On the other hand, in the case of bacteria, reconination will occur between their two loxP sites to cause insertion or deletion reaction (Figure 1). If insertion reaction can be caused in mammalian cells, any gene can be inserted subsequently, 15 thus resulting in a significantly wider range of applications. Since mammalian cells have large nuclei, circular DNA whose loxP has been. deleted will diffuse and little insertion reaction is observed. For this reason, the inventors of the present invention have attempted to introduce a mutation into a loxP sequence to cause insertion reaction such that once a 20 gene has been inserted into the genome, the inserted gene cannot be deleted (i.e., cannot be eliminated from the genome), and have designed several types of loxP mutants (lox66, lox7l, lox511, lox2272) for this purpose (Figure 1), These loxP mutants are known (WO01/005987., JP 2007-100 A). Moreover, in the present invention, systems under the name Vlox can also be 25 used. Vlox refers to a Vibrio spderived recombination system VCre-Vlox (Suzuki, E., Nakayama, M. VCre/VloxP and SCre/CloxP: new site-specific recombination systems for genome engineering. Nucleic Acid Res. 2011, 1-11), and Vlox43L, Vlox43R, Vlox2272 and so on are available for use (Figure 1). The nucleotide sequences of loxP and loxP mutants as well as Vlox systems 30 are shown below (Figure I). loxP: ATAACTTCGTA'IAGCATACATTATACGAAGTIAI' (SEQ ID NO: 1) lox7l: TACCGTTCGTATAGCATACATTATACGAAGTTAT (SEQ ID NO: 2) lox66: ATAACTTCQTATAG C ATACAIATACGAACGGTA (SEQ ID NO: 3) lox5 II: AJAACTTCGTATAGTATACATTATACGAAGTTAT (SEQ ID NO: 4) 12 G1097 1ox2272: ATAACTTCGTATAGGAIACTTAIACGAAGTTAT (SEQ ID NO: 5) Vlox: TCAATTTCTOAGAACTGTCATTCTCGGAAATTGA (SEQ ID NO: 6) Vlox43li: CGTGATTCTGAGAACTGTCATTCTCGGAAATTGA (SEQ ID NO: 7) 5 Vlox43R: TCAATfTTCTGAGAACTGTCATTCTCGGAATACCT (SEQ 1D NO: 8) Vlox2272: TCAATTTCTGAGAAGTGTCTTTCTCGGAAATTGA (SEQ ID NO: 9) Further, in the present invention, the Dre/rox system can be used (Figure 2), 10 Dre refers to D6 site-specific DNA recombinase, which is an enzyme capable of recognizing the sequence of the rox site shown below (Sauer, B. and McDermott, Nucic Acid. Res. 32: 6086-6095, 2004). A recombination system based on this recombinase and the rox recognition sequence is referred to as the Dre/rox system. This system is closely related to the Cre-lox system although they differ in their DNA 15 recognition specificity; The nucleotide sequences of lox and rox are shown below (Figure 2) rox: 5'-TAACTTTAAATAATGCCAATTATTTAAAGTTA-3 (SEQ ID NO: 10) 3'.ATTGAAATTTATTACGGTTAATAAATTTCAAT-5(SEQ ID NO: 11) lox: 5-AIAACTTCGiATAATGTATGCTAIACGAAGIAT-3i (SEQ ID NO: 12) 20 3 '-TATTGAAGCATATTACATACGATATGCTTCAATA-5' (SEQ ID NO: 13) As described above, the present invention aims to establish a mouse with a human normal liver, and further aims to establish a liver disease model mouse, For this purpose, in the present invention, ES cells are genetically engineered to ensure that 25 a toxin is expressed in the cytoplasm of mouse liver cells to induce cell death in the mouse liver cells, Moreover, for the reason that human liver cells should be transplanted and grown to create a mouse with a human normal liver, the mouse growth hormone gene in ES cells is replaced with the human growth hormone gene. In addition, for analysis of functions such as drug metabolism, mouse drug 30 metabolizing enzyme genes are replaced with human drug-metabolizing enzyme genes. A mouse introduced with liver cell death loses liver functions. Thus. this mouse not only can be used as a liver injury model, but can also be used to obtain a mouse with a humanized liver upon transplantation of human normal liver cells. Figure 3 shows a scheme for construction of a homologous recombination 13 G1097 vector for replacement of the mouse growth hormone (GH) gene with the bman OH gene, Likewise, Figure 4 shows a scheme for construction of a homologous recombination vector for replacement of the Cyp gene, a drug-metabolizing enzyme 5 gene, with Che human Cyp gene. Replacement of nouse genes with the above human genes can be accomplished in accordance with the gene trapping method described in WO01/005987. For example, two-step gene trapping may be conducted using a vector prepared as described above. 10 The first step is a commonly used gene trapping method. In this commonly used gene trapping, the above trapping vector is introduced into ES cells to trap an endogenous gene inherently present in the ES cells. As a result, the endogenous gene in the ES cells is disrupted. Then, a human gene is ligated downstream of the lox sequence (e.g, lx66) on a plasmid (replacement vector), followed by the second step 15 of gene trapping (Figures 3 and 4). In the second step of gene trapping, the human gene (e.g, hGH, hCyp) ligated downstream of 1ox66 is introduced into the ES cells. As a result, the iox7l site in the trapping vector introduced during the first step causes recombination with 1ox66 in the vector introduced during the second step, whereby a modified gene containing a 20 cassette composed of "(lox71/66)-(human gene) (loxP)" can be introduced. It should be noted that the purotnycin resistance gene (puro) may be ligated between the human gene and loxP. According to this method, endogenous mouse genes can be replaced with human genes. Figures 3 and 4 show the replaced alleles. 25 In Figures 3 and 4, Ext, Ex2, Ex3 and Ex4 represent exons I to 4, respectively, in. the mouse gro wth hormone gene or the mouse Cyp3al3 gene, pA represents a polyA sequence, Frt represents a FIP recognition site, PGK-neo represents the neomycin resistance gene ligated with PGK promoter, and P-puro represents the puromycin resistance gene lighted with PGK promoter. 30 5.Preparation of chimeic mouse Preparation of a chimeric mouse can be accomplished in a standard manner. First, the above established ES cells or gene-introduced or -replaced ES cells are allowed to aggregate with an eight-cell embryo or injected into a blastocyst. The 14 G1097 thus prepared embryo is referred to as a chimeric embryo, and this chimeric embryo is transplanted into the uterus of a pseudopregnant foster mother, which is then allowed to give birth, thereby preparing a chimeric mouse. For example, to prepare a chimeric embryo, a female mouse treated with a 5 hormone drug for superovulation may first be crossed with a male mouse, Then, after a given number of days have passed, an embryo at early development stage may be collected from the uterine tube or uterus. The collected embryo may be aggregated or injected with ES cells to prepare a chimeric embryo. The term "embryo" as used herein is intended to mean an individual at any 10 stage from fertilization to birth during ontogeny, including a two-cell embryo, a four cell embryo, an eight-cell embryo, a morula stage embryo, a blastocyst and so on. An embryo at early development stage can be collected from the uterine tube or uterus at 2.5 days after fertilization for use as an eight-cell embryo and at 3.5 days after fertilization for use as a blastocyst. 15 For preparation of an aggregate using ES cells and an embryo, known techniques such as the microinjection method, the aggregation method and so on can be used. The term "aggregate" is intended to mean an aggregate formed from ES cells and an embryo gathering together in the same space, and includes both cases where ES cells are injected into an embryo and where an embryo is dissociated into 20 separate cells and aggregated with ES cells. In the case of using the microirection method, the collected embryo may be injected with ES cells to prepare a cell aggregate, Alternatively, in the case of using the aggregation method, ES cells may be aggregated by being sprinkled over a normal embryo whose zona pellucida has been removed. 25 On the other hand, a pseudopregnant female mouse for use as a foster mother can be obtained frm a female mouse with normal sexual cycle by crossing with a male mouse castrated by vasoligation or other techniques. The thus created pseudopregnant mouse may be transplanted in the uterine with a chimeric embryo prepared as described above and then allowed to give birth, thereby preparing a 30 chimeric mouse. From among the thus prepared chimeric mice, a male mouse derived from the ES cell-transplanted embryo is selected. After the selected male chimeric mouse has been matured, this mouse may be crossed with a pure-line female mouse. Then, if the coat color of the ES cell-derived mouse appears in the born pups, it can be confirmed 15 G1097 that pluripotent stemn cells have been introduced into the germ line of the chinieric mouse, 6. Preparation of humanized mouse 5 (1) Preparation of genetically modified mouse which is most suitable for humanization Such a transgenic mouse (i.e., genetically modified mouse) established by using gene-introduced or -replaced ES cells is a mouse serving as a base for establishment of a mouse with a 100% humanized liver; as described later. To avoid rejection reactions, ES cells of NOJ mouse origin or ES cells of BRJ 10 mouse origin are used. (i) NOJ (NOD/SCiD/Jak3-/-) mouse: deficient in (3, T, B, NK and NKT For NOJ mouse preparation, an NOD mouse is crossed with an SCID mouse to introduce SCID gene mutations into the genetic background of NOD, and further 15 crossed with a Jak3-deficient mouse to obtain a mouse (NOJ mouse) having the genetic background of NOD with SCID and a deficiency in the Jak3 gene. This mouse is deficient in comnplement C3 and also deficient in T cells, B cells, NK cells and NKT cells. 20 (ii) BRJ (BA LB/c;Rag2-/-;Jak3-k) mouse: deficient in T, B, NK and NKT In the present invention, not only the above NOJ mouse, but also a BRJ mouse can be used. Such a BRJ mouse is a mouse having the genetic background of BALB/c mice introduced with deficiencies in the Rag2 and Jak3 genes. This mouse is deficient in T cells, B cells, NK cells and NKT cells. Nhen compared with the 25 NOJ mouse, the BRJ mouse is easy to breed, so that many mice can be produced. (2) Preparation of a liver injury model mouse For preparation of a liver injury model mouse, an antiestrogen may be administered to cause toxin expression to thereby elininate (kill) mouse liver cells, 30 thus obtaining an injury model mouse losing its liver functions. To kill mouse liver cells or to express Dre-ER' in the cytoplasm of mouse liver cells, the following constructs I and 2 are prepared. Dre-ER 2 is a vector car dying the Dre recombinase gene ligated to a mutated estrogen receptor gene modified to prevent binding with estrogen produced in the nmammalian body, 16 G1097 Construct 1: CAG-AO-rox-EGFP-rox-DT-A Construct 2: SAP-Dre-ER 2 5 Construct 1 is composed of (i) ATG, (ii) EFFP flanked by rox sites and (iii) DT-A (diphtheria toxin fragment A), which are ligated immediately downstream of the CAG promoter. This construct is designed to ensure in-frame ligation between the initiation codon in EGFP and ATG located upstream of rox. This construct is also designed to 10 remove the initiation codon in DT-A and to ensure in-frame ligation with ATG located upstream of rox. Construct 2 is composed of Dre-ER T ligated immediately downstream of the promoter for liver cell-specific serum amyloid P component (SAP). When these constructs I and 2 are co-introduced into the ES cells of the 15 present invention, site-specific recombination will occur after tamoxifen administration, and diphtheria toxin will be expressed in a manner specific to liver cells, whereby cell death can be induced., Namely, as a non-steroidal antiestrogen, for example, tamoxifen is a substance which has antitumor activity as a result of binding to the estrogen receptor in a manner 20 competitive with estrogen to thereby exert an anti-estrogenic effect. When Dre~ERT 2 _ expressing humanized mice are administered with tamoxifen, Dre-ERir2 will be internalized into their nuclei by the action of tamnoxifen. Combination between two rox sites will occur to allow the promoter for the diphtheria toxin gene to function, As a result, toxin DT-A will be expressed to kill mouse liver cells (Figure 5). 25 Tamoxifen may be administered at any frequency and for any period as long as liver cels can be killed, a though it is administered as follows, by way of example, Tamoxifen is dissolved in ethanol and the resulting solution is diluted with sun flower oil (85007, Sigma) to adjust the concentration at 7 mn/mI. This solution is used for administration to adults at a dose of 105 mg/kg body weight for successive 4 30 days via the intraperitoneal route. (3) Preparation of humanized mouse whose liver cells are replaced with human liver cells For preparation of a mouse whose liver cells are replaced with human liver 17 G1097 cells, mouse liver cells may be eliminated by antiestrogen administration and also human. liver cells may be transplanted into a mouse, as described above, thus obtaining a humanized mouse whose liver cells are replaced with human liver cells. Establishment of a mouse with a human normal liver is necessary to maintain 5 liver functions over a long period of time and confirm the safety. (i) Preparation of ES cells in which the mouse growth hormone gene is replaced with the corresponding human gene To ensure the growth of the transplanted human liver cells, the mouse growth hormone gene is replaced with the corresponding human gene at the stage of ES cells. 10 More specifically gene replacement in ES cells may be accomplished in two steps, as described above. In the first step, BRJ ES cells engineered to have SAP-Dre-ER 2 and CAG rox-EGFP-rox-DT-A (hereinafter referred to as BRJ ES:SAP-Dre-ER 2 :CAG-rox EGFP-rox-DT-A) are used for homologous recombination to dis rupt the mouse growth 15 hormone gene at its initiation codon and also establish ES cells carrying lox71-PGK neo-loxP integrated into this site (BR ES: :SAP-Dre-ER" 2 ; CAG-rox-EGFP-tox-DT A; Gh*leo). In the second step, these ES cells and a replacement vector may be used to establish ES cells carrying human growth hormone gene eDNA in place of the neo 20 gene (BRJ ES:SAP-Dre-ER T 2 ; CAG-rox-EGFP-rox-DT-A; Gh'cs"). The thus established ES cells may be used to obtain a mouse producing human growth hormone. (ii) Elimination of mouse liver cells and undifferentiated liver cells 25 The administration frequency and administration period of tamoxifen are the same as described above. (iii) Preparation of human liver cells to be transplanted Human liver cells to be transplanted may be induced from iPS cells. 30 Tb obtain human liver cells, efficient techniques can be established for induction of endodermal and hepatic differentiation from human iPS cells with the use of supporting cells or an extracellular matrix, iPS cells can be induced from somatic cells upon introduction of genes encoding 3 to 6 transcription factors (nucleus initialization factors) including members i8 G1097 of Oct. Sox, Kif Mye, Nanog, Lin and other families (fakahashi, K., et al Induction of pluripotent stem cells from fibroblast cultures, Nat. Protoc. 2, 3081-9 (2007); Fusaki N, 13an 1, Nishiyama A, Saeki K, Hasegawa M, Efficient induction of transgene-free human pluripotent stem cells using a vector based on Sendai virus, an RNA virus that 5 does not integrate into the host genome. Proc Jpn Acad Ser B Phys Biol Sei 2009; 85(8):348-62). Members of the Oct family include, for example, Oct3/4, Octl A, Oct6 and so on, with Oct3/4 being preferred. Members of the Sox (SRY-related HMG box) family include, for example, 10 Soxi, Sox2, Sox3, Sox7, Sox15 and so on, with Sox2 being preferred. Members of the Klf (Kruppel-like factor) family include, for example, Klfl, Klf2, Klf4, K.1f5 and so on, with Klf4 being preferred Members of the Myc family include c-Mye, N-Myc, L-Myc and so on, with c Myc being preferred. 15 Nanog is a homeobox protein that is most highly expressed in the inner cell mass of blastocysts, but not expressed in differentiated cells. Members of the Lin family include, for example, Lin28 which is used as a marker for undifferentiated human ES cells. More specifically, preferred transcription factors are a combination of Oct3/4, 20 Sox2, Klf4 and e-Myc (Takahashi, K, and Yamanaka, S., Cell 126, 663-676 (2006)), but it is also possible to use a combination of Oct3/4, Sox2 and Kif4 or a combination of Oct3/4, Sox2, Klf4 and L-Myc, Examples of somatic cells include skin cells, liver cells, fibroblasts. lymphocytes and so on. 25 Techniques for gene transfer into somatic cells include, but are not limited to, lipofection, electroporation, microinjection, virus vector-mediated transfer, etc. Virus vectors used for this purpose include, for example, retrovirus vectors, lentivirus vectors. adenovirus vectors, adeno-associated virus vectors. Sendai virus and so on. It is also possible to use commercially available vectors, as exemplified by Sendai virus 30 (DNAVEC), In the case of using vectors, a gene to be introduced may also be operably linked to a regulatory sequence (eg., a promoter, an enhancer) to ensure its expression, Examples of such a promoter include CMV promoter, RSV promoter, SV40 promoter and so on. These vectors may further comprise a positive selection marker such as a 19 G1097 drug resistance gene (e.g., puromycin resistance gene, neomycin resistance gene, ampicillin resistance gene, hygromycin resistance gene), a negative selection marker (e.g.. diphtheria toxin A fragment gene or thymidine kinase gene), IRES (internal ribosome entry site), a terminator, a replication origin and so on. 5 Somatic cells (e.g, 0.5 x 104 to 5 x 106 cells/100 rn dish) are transfected with a vector comprising the above nucleus initialization factors and cultured at about 37"C on MEF feeders or under feeder-free conditions, whereby iPS cells are induced after about 1 to 4 weeks. Examples of a medium include GMEM medium (Glasgow's Mininal 10 Essential Medium). DMEN (Dulbecco's Modified Eagle's Medium). RPMI 1640 medium, OPTI-MEIVIJ medium and so on. The culture medium may be supplemented as appropriate with an additional ingredient(s) selected from KSR (knockout serum replacement), fetal bovine senum (FBS), activin-A, basic fibroblast growth factor (bFGF), retinoic acid. dexamethasone, P-nercaptoethanol, nonessential amino acids, 15 glutamic acid, sodium pyruvate and antibiotics (e.g., penicillin, streptomycin), etc. Culture may be continued for a given period of time, followed by incubation in a medium containing EDTA or collagenase IV to collect the cells, as in the case of ES cell culture. Under feeder-free conditions, the cells may be cultured on Matrigel coated plates in an MEF-conditioned medium. 20 It is usual to induce differentiation from iPS cells into human liver cells via three steps. In principle, these three steps are as follows: (a) induction from pluripotent stem cells into the endodermal lineage, (b) induction from the endodernal lineage into immature liver cells, and (c) induction from the immature liver cells into mature liver cells. 25 In the above step (a), activin A and Wnt signals appear to be important, Likewise, FGF and BMP appear to be important in the step (b) while hepatocyte growth factor, oncostatin and dexametbasone appear to be important in the step (c). However, in the above steps (b) and (c), these important factors may be replaced as appropriate with DMSO or retinoic acid, and FGF4 or hydrocortisone and 30 so on. Transplantation of human liver cells may be conducted at 15.5 days of embryonic age or in adult mice at around 8 weeks after birth. The number of human liver cells to be transplanted is preferably 10' to 10', As to the route for transplantation of human liver cells, the cells may be 20 G1097 transplanted through injection into the yolk sac vessel in the case of embryos (Figures 6 and 7). In the case of adult mice, the cells may be injected into the spleen. (iv) Growth of human liver cells 5 The mouse established using ES cells in which the mouse growth hormone gene has been replaced with the human growth hormone gene is able to produce human growth hormone, This human growth hormone acts on the transplanted human liver cells to promote their growth, whereby it is possible to establish a humanized liver mouse with a human liver of normal size. 10 To confirm that all (100%) of the mouse liver cells have been replaced with human liver cells, i e. to confirm the absence of mouse liver cells, genes which are expressed in the mouse liver may be analyzed for their expression by RT-PCR or other techniques. 15 (4) Evaluation of humanized liver mouse To confirm that the liver has been humanized, the following characteristics may be tested either alone or in appropriate combination. (i) Verification of liver functions Characteristics to be tested for verification of liver functions include, for 20 example, those listed below. The test period is not limited in any way, but it is preferably one year or longer. Proteins: total protein, ALB, TTT, ZTT, CRP, Haptoglobin, C3, C4 Non-protein nitrogen component: total bilirubin, direct bilirubin Carbohydrate: ghicose 25 Lipid: triglyceride, total cholesterol, HDL-cholesterol, LDL-cholesterol, ApoAl, ApoCI Enzyme: lactate dehydrogenase (LDHt aspartate aminotransferase (AST (GOT)), alanine aminotransferase (ALT (OPT)), y-glutamyltransferase (GOT), creatine kinase (CK), alkaline phosphatase (AP), amylase (AML) 30 Others; calcium Fe, inorganic phosphate IC test: Indocyanine green (ICG) is intravenously administered and the ICG concentration in blood is measured over time to test the dye excretory function of the liver ICG is bound to lipoproteins in blood and transported to the liver, and is taken up into liver cells during passing through sinusoids and then excreted into bile without ,21 G1097 being conjugated. Thus, the functions of the liver can be analyzed as a whole organ, but not as liver cells. CT test: Morphological changes in the liver are tested. 5 (ii) Drug metabolism PCR array techniques are used to analyze the drug metabolism-related enzymes listed below; Cytochrome P450: CYPIIAl, CYPIBI. CYP1lB2, CYP17AI, CYP19AI, CYPIAI, CYPIA2, CYP1Bi CYP2iA2, CYP24Al, CYP26AI, CYP26B1, 10 CYP26CI, CYP27A1, CYP27Bl, CYP2AI3, CYP2RI, CYP2S1, CYP2B6, CYP2C1S, CYP2CI9, CYP2C8, CYP2C9., CYP2D6, CYP2Ei, CYP2FI, CYP2WI, CYP3A4, CYP3A43, CYP3A5, CYP3A7, CYP4A1I, CYP4A22. CYP4B1, CYP4Fl, CYP4F12, CYP4F2, CYP4F3, CYP4F8, CYP7AI, CYP7B1, CYP8BI. Alcohol dehydroge.nase: ADHIA, ADHIB. ADHI C, ADH4, ADH5, ADHI6. 15 ADH7, DHRS2, HSD17B10 (HADH2). Esterase: AADAC, CEL. ESD, GZMA, GZMB, UCHL1, UCHLA. Aldehyde dehydrogenase: ALDHI Al. ALDH1A2, ALDH1A3, ALDH1BI, ALDH2, ALDH3AI., ALDH3A2, ALDHIBI, ALDH3B2, AL DH4AI, Al DH5AI, ALDH6A1, ALDH7Ai, ALDH8AIALDH9A1. 20 Flavin-containing monooxygenase: FMOI, FMO2, FMO3, FMO4, FMO5. Monoamine oxygenase: MAOA, MAOB. Prostaglandin-endoperoxide synthase: PTGS1 , PTGS2. Xanthine dehydrogenase: XDH. Dihydropyrimidine dehydrogenase: DPYD. (iii) In vitro verification of liver cell functions Since liver cells are of endodermal origin, test cells may be examined for tine-dependent expression of genes which are expressed in the endodermal lineage and liver cells, accumulation of glycogen, expression of cytochrome enzymes and so 30 on to thereby verify whether the test cells have human liver functions. The time-dependent expression of genes which are expressed in the endodermal lineage and liver cells may be verified for Oct3/4, T, Gse, Mix1!, Foxa2, Hex, Hnfa, finf6, Afp Alb, TItr, aAl etc. Techniques for their verification include, 22 G1097 for example, commonly used Northern blotting, RTZPCR and Western blotting. The secretory ability of liver cells may be verified by measuring ALB, transferrin, alphal-antitrypsin and fibrinogen for their concentrations in the culture solution, Techniques for their verification include, for example. commonly used 5 Western blotting or EIA (enzyme-immuno assa)V The accumulation of glycogen may be verified by PAS (periodic acid~Schiff) staining. Periodic acid selectively oxidizes glucose residues to generate aldehydes, causing a color change to red purple by the action of Schiff"s reagent. The expression of cytochrome enzymes may be verified by analysis of five 10 major enzyrnes, i.e., CYP3A4, CYPiA2, CYP2C9, CYP2CI9 and CYP2D6. Techniques for their verification include, for example, commonly used Northern blotting, RT-PCR and Western blotting. (5) Preparation of liver disease model mouse whose liver cells are replaced with 15 human patient-derived liver cells The mouse of the present invention may be transplanted with human patient derived liver cells and also administered with an antiestrogen to eliminate liver cells originating from the mouse, whereby a human liver disease model mouse can be obtained. 20 Establishment of a mouse with a human mutated liver is necessary for establishment of a disease model having the same symptoms as seen in human patients and for pathology analysis. Moreover, a model optimized for human diseases is established and can be used for development of a novel therapy used for a wide range of purposes. 25 EXAMPLES The present invention will be further described in more detail by way of the following examples, although the present invention is not limited to these examples. 30 It should be noted that all applications for induction of liver cells from iPS cells, establishment of iPS cells from patients with human familial amyloid polyneuropathy or patients with human propionic acidemia, and transplantation experiments of the induced human liver cells into mice were approved by the ethical committee, the animal research committee, and the safety committee on recombinant DNA 23 G1097 experiments of class 2. [Example I] Establishment of ES cells 5 In this example, for establishment of a humanized optimal mouse most suitable for huran liver cell transplantation, ES cell lines were established from BRJ mouse embryos, and mouse strains thereof were also established, (1) Establishment of BALB/c;Rag2-/-;Jak3-/- (BRJ) mice and ES cell lines thereof 10 A Rag2-deficient mouse and a Jak3-deficient mouse were crossed with each other to establish a double-deficient mouse BI (Ono A, et al, J Biomed Biotechnol 2011; 539748, 2011. doi: 10.1155/2011/5397481)). The established BRJ mice were used for in vift fertilization to obtain 64 blastocyst embryos, which were then cultured in the conventionally used GMEM-KSR medium (14% KSR, 1% FBS, 1000 U/nl LIF 15 in GMEM) in an attempt to establish cell lines, but only two lines showing very poor growth were established. When used to prepare chimeric mice, these lines resulted in chimerism as low as 50% and did not contribute to the germ line. For this reason, the GSK3 inhibitor CI-IR99021 and the MEK inhibitor PD0325901, which are considered to be effetive 20 for maintenance of the undifferentiated state of ES cells, were added to the medium (GMEM-KSR-2i medium) in an attempt once again to establish ES lines, More specifically, BR embryos were collected by in vitro fertilization. 64 embryos were cultured in KSOM medium for 4 days until they became blastocysts, and the embryos were transferred on a one-by-one basis to 48 wells (coated with 25 gelatin alone). The medium used was KSR-GMEM-2i medium composed of G~ MEM (Glasgow minimum essential medium) supplemented with I X MEM nonessential amino acids, 01 11M p-mercaptoethanol, 1 mM sodium pyruvate, 1% fetal bovine serum (PBS) (Hyclone), 14% KnockoutM SR (KSR), 1100 uints/ml leukemia inhibitory factor ( 2), pM PD0325901 and 3 pM C111R99021. The 30 culture period was set to 14 days, during which the medium was replaced twice. After 14 days to 18 days, subculture was conducted from wells with increased 1CM to 24 wells containing feeder cells. Further, subculture was conducted sequentially in 12 wells 6 wells and 6-cm dishes, finally establishing 28 lines of ES cells having no problem in growth rate and morphology, 24 G1097 (2) Preparation of chinmeric mice using BRJ ES cell lines and establishment of BRJ Rag2-/-Jak3-/- mouse strains Among the established ES lines, 8 cell lines were used to prepare chimerie mice by being aggregated with inmrula embryos obtained by crossing between 56 female and BDF1 male mice (Table 1). Germ-line transmission was confirmed in 100% chineras obtained from three ES lines (BRJ-5, BRJ-6 and BRJ-8) (Table 2). 10 It should be noted that among the resulting ES cells, the 8th cell line was designated as "BR8" and internationally deposited under tte Budapest Treaty on March 23, 2012 (receipt date) with the National Institute of Technology and Evaluation, Patent Microorganisms Depositary (Patent Microorganisms Depositary, Department of Biotechnology of NITE, 2-5~8 Kazusakamatari. Kisarazu-shi, Chiba 292-0818, Japan). 15 Its Accession No. is "NITE BP- 12977 Table I Line No. Transfer Foster Newborn .White eyes 100% chimera 3 88 3 3 3 3 4 60 2 0 0 5 125 5 23 23 18 j 5 100 4 23 22 5e 4X passage 6 ' 125 5 13 11 3 , 4. 7 75 3 0 0 8 75 3 17 17 Died before __ffiwenmg 8 125 5 15 13 7e 4X passage 9 75 3 16 16 12 10 75 3 23 23 19 20 25 G1097 Table 2 Cop No. | Chimerism (d4/ 4) ES line Born 10% 20% 40% 60% 80% SD CD <10% 20% - 40% -60% -80%|-100% BRJ5-SDCD09 11.06.27 2 2 -/- -/- -/- -/ --- -1 BRJ5-SDCD18 11.07.04 1 3 2/--/. -. . - /. BRJS-SDCD4I 11.07.04 3 5 51- -1-.1/- -/- -/- -/ BRJ5-SDCD42 11.06.27 - - 4- -~~ -/- -14 -12 -/4 BRJ5-SDCD49 11.06.27 1 2 21- 3/- 3/ - -- - -I BRJS-SDCD55 11.0711 2 4 4- 5/ - 3/- 2- 31- 2/ BRJ5-SDCD68 11.06.27 1 2 3/- -1- 41- 41- - BRJ8-SDCD13 11.08.08 1 2 4- 1/- 3/- 1/- 2/ 1 BRJS-SDCD16 11.08.08 2 6 31- -1- 1/- 31- - / BRJ8-SDCD20 11.08.08 - - 41- 1/- 1/- -1- 1 BRJ8-SDCD27 11.08.08 1 5 3/ - 1/- -1- - BRJB-SDCD31 111.08.10 - - 31- 1/- 1/- - [ / BRJB-SDCD32 11.08.10 1 / 1 [Example 2] Induction of cell death in mouse liver cells 5 (1) Preparation of constructs for induction of cell death in mouse liver cells For preparation of a genetically modified mouse capable of specifically causing death in liver cell, two constructs were prepared. Construct 1 (CAG-ATG-rox-EGFP-rox-DT-A) is composed of AG EGFP flanked by rox sites and DT-A (diphtheria toxin fragment A), which are ligated 10 immediately downstream of the CAG promoter. This construct was designed to ensure in-frame ligation between the initiation codon in EGFP and ATG located upstream of rox. This construct was also designed to remove the iitiation codon in DT-A and to ensure in-frame ligation with ATG located upstream of rox. 15 Construct 2 (SAP-DreER' 2 ) is composed of D -re-FR- ligated immediately downstream of the promoter for liver cell-specific serum amyloid P component (SAP). In addition, the puromycin resistance gene is ligated upstream of the SAP promoter Detailed procedures are as shown below 20 (1-1) Construct I Construct I was prepared in the following nianner; (i) p6SEAZ and pSP-rox2 were treated with restriction enzymes PstI and KpnI, 26 G1097 respectively, and then blunt-ended with T4 Polymerase (TaKaRa). Subsequently, they were treated witb a restriction enzyme EcoRIF and ligated to each other to prepare pSP rox-EGFP-rox. (ii) pSP-rox-EGFP-rox and pBSK-atg-rox2 (synthetic DNA, Biomatik) were 5 treated with restriction enzymes EcoRI and Smal, and then ligated to each other to prepare pBSK-atg-rox-EGFP-rox. (iii) pBSK-atg-rox-EGFP-rox and P7IhAXC-DT were treated with restriction enzymes BamI and Psti, and then ligated to each other to prepare pBSK-atg-rox EGFP-rox-DT-A. 10 (iv) pCAGGS-EGFP and pBSK-atg-rox-EGFP-rox-DT-A were treated with restriction enzymes KpnI and Spel, respectively and then blunt-ended witr T4 Polymerase (TaKaRa) Subsequently, they were treated with a restriction enzyme Hind III and then ligated to each other to prepare CA.G-atg-rox4IFP-rox-DLA. 15 (1-2) Construct 2 Construct 2 was prepared in the following maner, (i) pkSAP-DrePP was used as a template in PCR to amplify a region covering from the initiation codon to the last codon before the stop codon. The reverse primer was provided with a BamHI site. 20 PCR kit: TaKaRa Ex Taq Fw Primer: CCATGGCCCCCAAGAAGAAAA (SEQ ID NO: 14) Re Primer: CGGGATCCATGA.GCCTGCTGTT (SEQ ID NO: 15) pGEM-T Easy Vector and the above PCR product were ligated to each other to prepare T easy-Dre. 25 (ii) pkSAP-DrePP and T easy-Dre were treated with restriction enzymes Sall and EcoRI, and then ligated to each other to prepare T Easy SAR (iii) The above T Easy Dre and T easy-SAP were treated with restriction enzymes SaclI and Not!, and then ligated to each other to prepare 'T easy-SAP-Dre. (iv) T Easy-SAP-Dre and pkSA-CremER' 2 PP were used and treated with 30 restriction enzymes BamlHI and NotL, and then ligated to each other to prepare T easy SAP-DremER (v) pkSAP-DrePP and T easy-SAP-DremERr vere heated with restriction enzymes Sall and NotI, and then ligated to each other to prepare pKSAP-DreER T2 . (vi) pKSAP-DreERT2 and pFPacpaF2 were treated with restriction enzymes Spel 27 G1097 and Kpnl respectively, and then bluntended with T4 polymerase (TaKaRa), Subsequently, pKSAP-DreERiz and pFPacpaF2 were treated with restriction enzymes Sall and XhoI respectively, and then ligated to each other to prepare Puro-SAP DreERT 2 . 5 (2) Introduction of estrogen receptor gene and diphtheria toxin gene into ES cells Conditions were studied to ensure efficient expression of human genes upon insertion (Li, Z. et al. Traisgenic Res. 20:191-200, 2011 DOI 10l007/s11248-010 9389-22). 10 The presence or absence of a PGK-puromycin cassette and IRES was analyzed to determine which combination would achieve the highest expression efficiency. Prior to the analysis, a homologous recombination vector was used to disrupt the first exon of the mouse transthyretin (Ttr) gene in a standard manner (Zhao, G., Li, 15 Z,, Araki, K., Haruna, K., Yamaguchi, K., Araki, M., Takeya, M., Ando, Y. and Yamamura, K. Inconsistency between hepatic expression and serum concentration of transthyretin in mice humanized at the transthyretin locus. Genes Cells 13: 1257-1268, 2008), During this treatment, ATG in the first exon was disrupted, resulting in a target recombinant clone carrying lox7 I-PGK-beta-geodoxP-polyA-iox2272 integrated 20 into this site. Then, two types of replacement vectors were prepared. Replacement vector 1 comprises lox66-hTTR eDNA-polyA-Frt-PGK-puro-Frt-loxP, while replacement vector 2 comprises lox66-IRES-hTTR cDNA-polyA-Frt-PGK-puro-Frt-iloxP These replacement vectors were each introduced together with a Crc expression vector into 25 the target recombinant clone by electroporation As a result, the following two clones were obtained lox7l/66-hTTR cDNA polyA-Frt-PGK-puro-lrt-oxP (abbreviated as It)P(+)) and lox7l/66-iRES-hiTR cDNA-polyA-Frt-PGK-puro-Frt-loxP (abbreviated as I(+)P(+)), These two clones each have PGK-puro, but I(P() has no [IES. 30 Into these two clones, CAG-FLP was introduced by electroporation and PGK puro between Frit sites was deleted to prepare IQ-)P(-) and i(+)P(-) clones. Mice were prepared from these four ES clones and subjected to expression analysis, indicating that 1(-)P(+) showed the highest expression, followed by I(~)P(), i(+)P(+) and i(4)P(-) in decreasing order. Moreover, in the case of I(-)P(-), human 28 G1097 TTR (transthyretin) expression in the liver was found to be substantially equal to the expression levels of mouse Ttr (transthyretin) in control mice. As a result, a combination of the presence of PGK-puronycin and the absence of IRES was found to achieve the highest expression efficiency for the inserted human 5 gene. [Example 3] Replacement with human growth hormone gene Prior to the experiment, a homologous recombination vector was used to disrupt the first exon of Pie mouse growth hormone (Gh) gene in a standard manner as 10 in the case of Example 2. During this treatment, ATO in the first exon was disrupted, resulting in a target recombinant clone carrying lox7I GK-beta-geo-loxP-polvA 1ox2272 integrated into this site, Then, a replacement vector was prepared. The replacement vector comprises 1ox66-hG-1 cDNA-polyA-Prt-PGK-puro-Frt-loxP. This replacement vector was introduced together with a Cre expression vector into the 15 target recombinant clone by electroporation. As a result, an ES clone in which the mouse Gh gene was replaced with the human GH gene was obtained. [Example 4] Replacement with human drug-retabolizing enzyme gene 20 Prior to the experiment, a homologous recombination vector was used to disrupt the first exon of the mouse Cyp3al 3 gene in a standard manner. During this treatment, ATG in the first exon was disrupted, resulting in a target recombinant clone carrying lox 71-PGK-beta-geo-loxP-polyAdox2272 integrated into this site. Then, a replacement vector was prepared. The replacement vector comprises iox66 25 hCYP3cA4 DNA-polyAr-Ft-PGapuro-FrtdoxP. This replacement vector was introduced together with a Cre expression vector into the target recombinant clone by electroporation. As a result, an ES clone in which the mouse Cyp3al3 gene was replaced with the human CYP3A4 gene was obtained. 30 [Example 5] Preparation of mouse whose liver is humanized Techniques to induce differentiation from human i.PS cells into human liver cells were substantially established, and constructs for induction of cell death in mouse liver cells were also prepared. 29 G1097 (1) Induction of differentiation from hunan iPS cells into liver cells Efficient techniques were constructed for induction of endodernal and hepatic differentiation from human iPS cells with the use of supporting cells or an extracellular matrix. 5 For purification of differentiated liver cells and for evaluation of differentiation induction efficiency, a human iPS cell line carrying an albumin-reporter gene was established and used for development of differentiation induction techniques. Culture matrixes used for this purpose include M15 cells serving as supporting cells (feeder cells), a synthesized basement membrane (sBM), Cell-able and so on. 10 To cause differentiation from iPS cells into human liver cells, a 4P500 mg/l glucose DMEM medium was used for culture from the first day to the 9th day This DMEM medium contains the following: insulin (10 mg/I), transferrin (5.5 mg/i), sodium selenite (6.7 mg/ml), ALBUMAX 1 (2.5 mg/mD. 100 mM nonessential amino acids, 2 mM L-glutaimine, 50 mg/mil streptomycin, 100 pM Q-mercaptoethanol, activin 15 A (20 ng/ml), and bFGF (50 ng/ml). Subsequently, culture was continued in the presence of retinoic acid (106 M) from the 9th day to the 11th day. Finally, front the 1Ith day to the 30th day, the cells were transferred to and cultured in a 2,000 mg/I glucose DMEM medium to complete their differentiation into 20 liver cells, The DMIEM medium used for this purpose contains the following: 10% KSR, 100 mM nonessential amino acids, 2 nmM L-glutamine, 50 mg/ml streptomycin, 100 p.M P-mercaptoethanol, hepatocyte growth factor (10 ng/ml), dexamethasone ( mM), dimethylsulfoxide (%), and nicotinamide (1 mM). 25 (2) Study of transplantation techniques for iPS-derived human liver cells With the aim of establishing techniques for efficient introduction of iPS derived liver cells into mouse livers, which are required for humanization of livers, a preliminary experiment was conducted to introduce iPS-derived human liver cells through the blood vessel (yolk sac vessel) present on the mouse fetal amniotic 30 membrane at 17 days of embryonic age (Figures 6 and 7). Glycerol micelles encapsulating (A) a dye (blue dye) and (B) a GFP expression vector were introduced through the blood vessel present on the amniotic membrane at 17 days of embryonic age and confirmed for their introduction efficiency. As a result, the injectants were confirmed to be concentrated and localized in 30 G1097 the liver and found to be throughout the liver, Moreover, the survival and delivery of fetuses were not affected even after this treatment, and neonatal mice whose livers were efficiently introduced with both injectants (A) and (B) were born, 5 The liver cells prepared in (1) above were used for transplantation. Figure 8 shows liver cells induced to differenti ate on MI 5 and slBM. Then, to induce a large number of liver cells, culture plates under the name Cell-able (Toyo Gosei Co. Ltd., Tokyo) were used for culture. As a result, culture for 30 days was sufficient to induce differentiation into a 10 large number of liver cells, as expected, and spheroid formation was also observed (Figure 9). In either culture method, iPS cells were induced to differentiate into Sox17 positive endoderm at the 10th day of culture, AFP-positive immature liver cells at the 20th day of culture, and ALBUMIN-positive mature liver cells at the 30th day of 15 culture. For functional evaluation of these mature liver cells induced to differentiate, glycogen accumulation was evaluated by PAS staining, while the detoxication ability was evaluated by indocyanine green (ICG) staining. As a result, the liver cells induced to differentiate were found to have desired 20 functions. In addition, the liver cells showed no mouse gene expression when analyzed by RT-PCR with mouse specific primers, thus indicating that 100% of the liver cells were of human origin. 25 [Example 6] Establishment of mutated humanized liver mice In this example, FAP and PA model mice were bred, (1) Induction of mutated liver cells from human patients (i) Familial amyloid polyneuropathy (FAP): already established FAP is an autosomal dominant hereditary disease caused by a point mutation 30 in the transthyretin (TTR) gene. For examplein LFAP, a replacement of valine with methionine occurs at amino acid position 30 in the amino acid sequence of transthyretin (Val3OMet). Fibroblasts taken from patients having this Val30Met mutation were used to establish iPS cells. As a result, it was indicated that these iPS cells were able to be induced to 31 G1097 differentiate into liver cells in the same manner as described previously. (ii) Establishment of iPS cells from human propionic acidemia (PA) patients PA is an autosomal recessive hereditary disease caused by a defect in the 5 propionyl CoA carboxylase (PCCA) gene. For example, in PA, a replacement of arginine with tryptophan occurs at position. 52 in the amino acid sequence of PCCA (Arg52Trp). Fibroblasts taken from patients having this mutation were used to establish PS cells. As a result, it was indicated that these iPS cells were able to be induced to differentiate into liver cells in the same manner as described previously 10 (2) Establishment of mutated humanized liver mice (model mice for PAP and PA) Mutated humanized liver mice may be established in the same manner as used to prepare a humanized liver mouse (i.e., a mouse prepared by transplantation of liver cells induced from normal human-derived iPS cells). Namely,; the mouse of the 15 present invention may be transplanted with liver cells induced to differentiate from iPS cells derived from FAP and PA patients to thereby establish the mutated humanized liver mice. INDUSTRIAL APPLICABILITY 20 The present invention provides ES cells derived from an immunodeficient mouse. An embryo prepared using the ES cells of the present invention may be transplanted with human liver cells to thereby create a mouse with a humanized liver, which can be used to examine human liver functions. 25 Deposition Number Microorganism is labeled as: "BRJ8" Accession No.: N iE B 1l297 Initial deposit date (receipt dale): March 23 2012 30 International Deposition Authority: National Institute of Technology and Evaluation, Patent Microorganisms Depositary Patent Microorganisms Depositary, Department of Biotechnology of NITE, 2 5-8 Kazusakamatari, Kisarazu-shi, Chiba 292-0818, Japan 32 G1097 Sequence Listing Free Text SEQ ID NOs: 1 to 15: synthetic DNAs 33
权利要求:
Claims (9) [1] 2. The embryonic stem cell according to claim 1, which is deposited under Accession No. NITE BP- 1297, 10 3. The embryonic stem cell according to claim 1 or 2. which is engineered to have the estrogen receptor gene and the diphtheria toxin gene. [2] 4. The embryonic stem cell according to claim 3, wherein the endogenous growth hormone gene in the cell is replaced with that of human origin. 15 [3] 5. The embryonic stem cell according to claim 4, wherein an endogenous drug~ metabolizing enzyme gene in the cell is further replaced with that of human origin. [4] 6. The embryonic stem cell according to claim 5, wherein the endogenous drug 20 metabolizing enzyme gene in the cell is at least one selected from the group consisting of Cyp3a11, Cyp3al3, Cyp3a25 and Cyp3a4l. [5] 7. A mouse, which is created with the use of the embryonic stein cell according to claim I or 2. 25 8, A. transgeraic mouse, which is created with the use of the enbryonic stern cell according to any one of claims 3 to 6. [6] 9. The mouse according to claim 8, which develops liver cell injury upon 30 administration, of an antiestrogen. [7] 10. A mouse with a humanized liver; wherein the mouse according to claim 8 is transplanted with liver cells of human origin and also administered with an antiestrogen to eliminate liver cells originating from the mouse. 34 G1097 1.L The mouse according to claim 10, wherein the liver cells of human origin are derived from a patient with a liver disease. 5 12. A human liver disease model mouse, which consists of the mouse according to claim IL 13 A method for preparing an immunodeficient mouse-derived embryonic stem cell, which comprises culturing an embryo of an immunodeficient mouse which is 10 deficient in both Rag2 and Jak3 genes in the presence of a 0SK3 inhibitor and an MEK inhibitor. [8] 14. A method for creating a liver injury model mouse, which comprises administering an antiestrogen to the mouse according to claim 8, 15 [9] 15. A method for creating a mouse with a humanized liver, which comprises transplanting liver cells of human origin into the mouse according to claim 8 and also administering an antiestrogen to eliminate liver cells originating from the mouse. 20 16. The method according to claim 15, wherein the liver cells of human origin are derived from a patient with a liver disease. 35
类似技术:
公开号 | 公开日 | 专利标题 JP2019030310A|2019-02-28|Organ regeneration method using iPS cells and BLASTOCYST COMPLEMENTATION US7294754B2|2007-11-13|Method for generating an animal homozygous for a genetic modification Buehr et al.2008|Capture of authentic embryonic stem cells from rat blastocysts JP2020043864A|2020-03-26|Production method of heterogeneous germinal vesicle chimera animal using stem cell CN101932705A|2010-12-29|Reprogramming of somatic cells AU2012374750B2|2017-02-02|Humanized mouse US20180360006A1|2018-12-20|Organ humanized mouse WO2021174742A1|2021-09-10|Animal preparation method Board2010|Program and Abstracts of the 9th Transgenic Technology Meeting |
同族专利:
公开号 | 公开日 US20150052625A1|2015-02-19| CN104378975A|2015-02-25| JPWO2013145331A1|2015-12-10| CA2868292A1|2013-10-03| AU2012374750B2|2017-02-02| EP2832221A1|2015-02-04| HK1202773A1|2015-10-09| KR101708541B1|2017-02-20| KR20140144698A|2014-12-19| JP5871412B2|2016-03-01| EP2832221A4|2015-10-14| WO2013145331A1|2013-10-03|
引用文献:
公开号 | 申请日 | 公开日 | 申请人 | 专利标题 AU7492291A|1990-02-26|1991-09-18|Board Of Trustees Of The Leland Stanford Junior University|Identification and expression of insect steroid receptor dna sequences| JP2000508895A|1996-04-05|2000-07-18|ザソールクインスチチュートフォアバイオロジカルスタディズ|Hormone-mediated methods for regulating the expression of foreign genes in mammalian systems and related products| EP1201759B1|1999-07-14|2010-03-10|Transgenic Inc.|Trap vector and gene trapping method by using the same| US6509514B1|2000-03-17|2003-01-21|Kmt Hepatech, Inc.|Chimeric animal model susceptible to human hepatitis C virus infection| JP4836503B2|2005-06-27|2011-12-14|株式会社トランスジェニック|Knockout non-human animals| EP2457995A1|2006-03-30|2012-05-30|The University Court of The University of Edinburgh|Culture medium containing kinase inhibitors, and uses thereof| JP5073836B2|2009-01-16|2012-11-14|公益財団法人実験動物中央研究所|Mice transplanted with human hepatocytes| EP2508595B1|2009-12-01|2016-11-23|National Cancer Center|Method for constructing chimeric rat using rat embryonic stem cells| JPWO2011149102A1|2010-05-24|2013-07-25|国立大学法人 熊本大学|Highly immunodeficient mice optimized for in vivo imaging|JP5899388B1|2015-06-18|2016-04-06|株式会社トランスジェニック|Organized humanized mouse| CN105145486A|2015-07-22|2015-12-16|中国医学科学院医学实验动物研究所|Application of RAG2 gene knockout rat in establishing personalized tumor treatment model| WO2018161417A1|2017-03-07|2018-09-13|浙江大学|Method for constructing humanized mouse model for chronic hepatitis b by using stem cells| CN109735485B|2019-01-29|2021-04-16|深圳市拓普生物科技有限公司|Humanized liver animal model and construction method and application thereof| JP2021029174A|2019-08-26|2021-03-01|株式会社フェニックスバイオ|Human fatty liver model cell|
法律状态:
2017-02-16| DA3| Amendments made section 104|Free format text: THE NATURE OF THE AMENDMENT IS: AMEND THE NAME OF THE INVENTOR TO READ YAMAMURA, KEN-ICHI; ARAKI, KIMI; OKADA, SEIJI AND SHIMONO, AKIHIKO | 2017-06-01| FGA| Letters patent sealed or granted (standard patent)| 2018-10-25| MK14| Patent ceased section 143(a) (annual fees not paid) or expired|
优先权:
[返回顶部]
申请号 | 申请日 | 专利标题 PCT/JP2012/058790|WO2013145331A1|2012-03-27|2012-03-27|Humanized mouse| 相关专利
Sulfonates, polymers, resist compositions and patterning process
Washing machine
Washing machine
Device for fixture finishing and tension adjusting of membrane
Structure for Equipping Band in a Plane Cathode Ray Tube
Process for preparation of 7 alpha-carboxyl 9, 11-epoxy steroids and intermediates useful therein an
国家/地区
|